comK [2017-12-15 16:53:36]

competence transcription factor (CTF)

Locus: BSU10420

Isoelectric point: 7.67

Molecular weight: 22.28 kDa

Protein length: 192 aa

Gene length: 576 bp

Function: regulation of genetic competence and DNA uptake

Product: competence transcription factor (CTF)

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Genetics → Genetic competence
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other
• Lifestyles → Exponential and early post-exponential lifestyles → Genetic competence
• Groups of genes → Phosphoproteins → Phosphorylation on an Arg residue

Gene

Coordinates: 1,117,109 → 1,117,687

Phenotypes of a mutant

• no expression of competence genes, loss of genetic competence PubMed

The protein

Modification

• phosphorylated on Arg-65, Arg-157, Arg-161, Arg-165, Arg-186, and Arg-191 PubMed

Additional information

• degraded by ClpC-ClpP (with MecA as adaptor protein) PubMed

Expression and Regulation

Operons

• Genes: comK
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • Rok: repression, PubMed, in Rok regulon
  • CodY: repression, PubMed, in CodY regulon
  • AbrB: repression, PubMed, in AbrB regulon
  • ComK: activation, (autoregulation) PubMed, in ComK regulon
  • DegU: activation, in DegU regulon
  • Spo0A: activation, Spo0A-P, acts as antagonist of Rok PubMed, in Spo0A regulon

  Regulation

  • comK has a bistable expression pattern PubMed
  • expression is reduced in a cwlO mutant PubMed

Additional information

• full expression of comK requires fully assembled and rotating flagella PubMed
• DegU-P represses comK expression PubMed

Biological materials

Mutant

• 1A871 (no resistance), [Pubmed| ], available at BGSC
• BKE10420 (ΔcomK::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTATGGCCTCCATCCT, downstream forward: _UP4_TAGAAAAATAGGAAGGAGCT
• BKK10420 (ΔcomK::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTATGGCCTCCATCCT, downstream forward: _UP4_TAGAAAAATAGGAAGGAGCT

Expression vector

• for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab

Labs working on this gene/protein

• Oscar Kuipers, University of Groningen, The Netherlands
• Homepage

References

Reviews

Loading

The ComK regulon

Loading

Original Publications

Loading